preserved

Soricidae ›› Scutisorex congicus

Taxonomy

Family: Soricidae Genus: Scutisorex Species: Scutisorex congicus
Determination: Scutisorex congicus
Determinator(s): Sylvestre Gambalemoke
Determination year: -
Determination accur.: regional expert in the taxa with high certainty

Specimen Information

Specimen number: -
Field number: BA186
Type: -
State: alcohol
Collector(s): Sylvestre Gambalemoke
Collection date: 2006-09-24
Trap method: Pitfall trap
Disposition: in collection
Basis of record: preserved specimen
Sex: female
Sexual condition: -
Lifestage: -

Distribution & Ecology

Locality: Baliko
Country: Congo (DR)
Altitude: -
Latitude: 0.641529977322
Longitude: 26.3638896942
Habitat(s): secondary forest
Extra habitat info: -

Pictures

Measurements

To export measurements, go to Scutisorex or Scutisorex congicus .
Weight: 49.0 g
hb: 131.00 mm
tl: 80.00 mm
hf: 19.40 mm
el: 11.10 mm
An explanation of those measurements is available in the about section of this website.

DNA Sequences

To export sequences, go to Scutisorex or Scutisorex congicus .
Type: 16s rRNA
AATAAGTATTAGAGGCACTGCCTGCCCAGTGACATTAGTTAAACGGCCGCGGTATCCTGACCGTGCAAAGGTAGCATAATCATTTGTTCCTTAATTAGGGACTTGTATGAATGGCCACACGAGGGTTTAACTGTCTCTTACTTTCAATCAGTGAAATTGACCTTCCCGTGAAGAGGCGGGAATAAAAAAATAAGACGAGAAGACCCTATGGAGCTTAAATTAAACTATTCAATAATTTAAACATAATTCCCACAGGAACAAAGACACATTATATGAATAATAAATTTTGGTTGGGGTGACCTCGGAGTATAAAACAACCTCCGAGTAATTTAAACCAAGACTCACTCGTCAAAGTAATAAAGCCTATTGATCCAATCATATTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTTAAGAGTTCACATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACACCCAAATGGTGCAGCAGCTATAAA

Tests & Tissues

Tested on: no tests available.
Tissue samples: no tissue samples available.