preserved

Soricidae ›› Scutisorex congicus

Taxonomy

Family: Soricidae Genus: Scutisorex Species: Scutisorex congicus
Determination: Scutisorex congicus
Determinator(s): Frederik Van de Perre
Determination year: -
Determination accur.: regional expert in the taxa with high certainty

Specimen Information

Specimen number: -
Field number: COB1244
Type: -
State: alcohol
Collector(s): Frederik Van de Perre
Collection date: 2016-07-20
Trap method: Pitfall trap
Disposition: in collection
Basis of record: preserved specimen
Sex: female
Sexual condition: perforated vagina, small nipples, not pregnant
Lifestage: -

Distribution & Ecology

Locality: Yangambi Biosphere Reserve
Country: Congo (DR)
Altitude: -
Latitude: 0.79310798645
Longitude: 24.4901008606
Habitat(s): secondary forest
Extra habitat info: -

Pictures

Measurements

To export measurements, go to Scutisorex or Scutisorex congicus .
Weight: 26.0 g
hb: 131.00 mm
tl: 77.00 mm
hf: 20.40 mm
el: 9.40 mm
An explanation of those measurements is available in the about section of this website.

DNA Sequences

To export sequences, go to Scutisorex or Scutisorex congicus .
Type: 16s rRNA
TAATCGTTGAACAAACGAACCTTTAATAGCTGCTGCACCATTTGGGTGTCCTGATCCAACATCGAGGTCGTAAACCCTATTGTCGATGTGAACTCTTAAATAGGATTGCGCTGTTATCCCTAGGGTAACTTGTTCCGTTGATCAATATGATTGGATCAATAGGCTTTATTACTTTGACGAGTGAGTCTTGGTTTAAATTACTCGGAGGTTGTTTTATACTCCGAGGTCACCCCAACCAAAATTTATTATTCATATAATGTGTCTTTGTTCCTGTGGGAATTATGTTTAAATTATTGAATAGTTTAATTTAAGCTCCATAGGGTCTTCTCGTCTTATTTTTTTATTCCCGCCTCTTCACGGGAAGGTCAATTTCACTGATTGAAAGTAAGAGACAGTTAAACCCTCGTGTGGCCATTCATACAAGTCCCTAATTAAGGAACAAATGATTATGCTACCTTTGCACGGTCAGGATACCGCGGCCGTTTAACTAATGTCACTGGGCAGGCAGTGCCTCTAATACTTATTATGCTAGAGGTGATGGTTTTT

Tests & Tissues

Tested on: parasites tested (PA).
Tissue samples: liver (alcohol), spleen (alcohol), blood (filter paper), kidney (RNAlater).